The effect of aerobic training and probiotic intake on gene ICAM–1 expression in rats with nonalcoholic fatty liver
Subject Areas : Exercise Training and Diseases
Samaneh Hadipour Ahmadi
1
,
Abdolrasoul Daneshjoo
2
*
1 - MSc in Exercise Physiology, Department of Physical Education and Sport Sciences, East Tehran Branch, Islamic Azad University, Tehran, Iran
2 - Assistant Professor of Exercise biomechanics, Department of Physical Education and Sport Sciences, East Tehran Branch, Islamic Azad University, Tehran, Iran
Keywords: Non-alcoholic fatty liver, Probiotic, ICAM-1, ALP,
Abstract :
Background: Cell adhesion molecules mediate leukocyte responses to inflammation. The purpose of study was to the effect of aerobic training and probiotic intake on ICAM–1 in rats with fatty liver. Materials and Methods: In this experimental study, 32 rats (200-250 gr) were randomly divided into four groups (healthy control, steatosis, steatosis + probiotic, steatosis + probiotic + training). To create a fatty liver model, tetracycline at a dose of 100 mg / kg in a volume of 1.5 cc was gavaged daily for two weeks. The training program includes 8 weeks and 5 sessions per week, in the initial week with a speed of 18 meters per minute, time started 10 minutes and every week quickly, 1-2 meters per minute and time was added to 10 minutes. Supplemental groups received 109 CFU / ml of Lactobacillus ramensus by gavage daily for 8 weeks and 5 days per week. Liver tissue samples were taken to examine the expression of ICAM-1 gene. 10 ml of blood was collected from the hearts of rats for ALP testing. The data was analyzed using one-way analysis of variance (ANOVA) p05/0≥. Results: The results showed that the aerobic training along with probiotic consumption significantly reduced the expression gene of ICAM-1 and ALP in rats with non-alcoholic fatty liver. Conclusion: It seems aerobic training combined with probiotic consumption improved the expression gene of ICAM-1 and ALP enzyme in the studied samples which can be effective in treating patients with fatty liver disease
1. Farzanegi P, Pour Amin Z, Habibian M. Changes of Liver Trans-Aminases after a Period of Selected Aerobic Training in Postmenopausal Women. Med Laboratory J 2014; 8(1): 22-8. URL: http://mlj.goums.ac.ir/article-1-406-en.html
2. Bacchi E, Negri C, Targher G, Faccioli N, Lanza M, Zoppini G, Zanolin E, Schena F, Bonora E, Moghetti P. Both resistance training and aerobic training reduce hepatic fat content in type 2 diabetic subjects with nonalcoholic fatty liver disease (the RAED2 Randomized Trial). Hepatology. 2013 Oct;58(4):1287-95. doi: 10.1002/hep.26393. Epub 2013 Aug 22. PMID: 23504926.
3. Masarone M, Federico A, Abenavoli L, Loguercio C, Persico M. Non alcoholic fatty liver: epidemiology and natural history. Rev Recent Clin Trials. 2014;9(3):126-33. doi: 10.2174/1574887109666141216111143. PMID: 25514916.
4. Liu Z, Que S, Xu J, Peng T. Alanine aminotransferase-old biomarker and new concept: a review. Int J Med Sci. 2014 Jun 26;11(9):925-35. doi: 10.7150/ijms.8951. PMID: 25013373; PMCID: PMC4081315.
5. Eschen O, Christensen JH, Toft E, Schmidt EB. Soluble adhesion molecules and marine n-3 fatty acids in patients referred for coronary angiography. Atherosclerosis. 2005 Jun;180(2):327-31. doi: 10.1016/j.atherosclerosis.2004.12.006. Epub 2005 Jan 24. PMID: 15910859.
6. Lin G, Duan X, Cai X, Tian L, Xu Z, Fan J. Hepatocyte steatosis increases the expression of adhesion molecules in endothelial cells. Asian Biomedicine 2010; 4(5): 757-63. DOI: 10.2478/abm-2010-0098
7. Lebda MA. Acute Iron Overload and Potential Chem-otherapeutic Effect of Turmeric in Rats. Int J Pure App Biosci 2014; 2(2):86-94.I SSN: 2320 – 7051 INTERNATIONAL JOURNAL OF PURE & APPLIED BIOSCIENCE
8. Mousavi Nezhad S A, Jafari P, Tajabadi Ebrahimi M, Zilabi R. The Effect of Iran Probiotic Fermented Milk Beverage on Cholesterol and Liver Function Biomarkers of Rat. J Police Med. 2015; 4 (1) :49-56
URL: http://jpmed.ir/article-1-321-en.html.
9. Thoma C, Day CP, Trenell MI. Lifestyle interventions for the treatment of non-alcoholic fatty liver disease in adults: a systematic review. J Hepatol. 2012 Jan;56(1):255-66. doi: 10.1016/j.jhep.2011.06.010. Epub 2011 Jul 1. PMID: 21723839.
10. Lata J, Jurankova J, Kopacova M, Vitek P. Probiotics in hepatology. World J Gastroenterol. 2011 Jun 28;17(24):2890-6. doi: 10.3748/wjg.v17.i24.2890. PMID: 21734800; PMCID: PMC3129503.
11. Lye HS, Kuan CY, Ewe JA, Fung WY, Liong MT. The improvement of hypertension by probiotics: effects on cholesterol, diabetes, renin, and phytoestrogens. Int J Mol Sci. 2009 Aug 27;10(9):3755-75. doi: 10.3390/ijms10093755. PMID: 19865517; PMCID: PMC2769158.
12. Iacono A, Raso GM, Canani RB, Calignano A, Meli R. Probiotics as an emerging therapeutic strategy to treat NAFLD: focus on molecular and biochemical mechanisms. J Nutr Biochem. 2011 Aug;22(8):699-711. doi: 10.1016/j.jnutbio.2010.10.002. Epub 2011 Feb 2. PMID: 21292470.
13. Nabavi S, Rafraf M, Somi MH, Homayouni-Rad A, Asghari-jafarabadi M. The effects of probiotic yogurt on metabolic factors in nonalcoholic fatty liver disease. SJKU 2016; 20 (6):12-25. PMID: 25306266 DOI: 10.3168/jds.2014-8500
14. Rafraf M, Nabavi S, Somi M, Homayouni-Rad A, Asghari-Jafsrabadi M. Effect of Probiotic Yogurt on Enzymes and Ecogenisity of Liver in Individuals with non-Alcoholic Fatty Liver Disease: A Double-Blind Randomized Controlled Clinical Trial. J Adv Med Biomed Res 2015; 23 (99):25-38. PMID: 25306266 DOI: 10.3168/jds.2014-8500.
15. Shirvani H, Aslani J. The effects of high-intensity interval training vs. moderate-intensity continuous training on serum irisin and expression of skeletal muscle PGC-1α gene in male rats. Tehran Univ Med J. 2017; 75 (7) :513-520
URL: http://tumj.tums.ac.ir/article-1-8337-en.html
16. Wong VW, Chu WC, Wong GL, Chan RS, Chim AM, Ong A, Yeung DK, Yiu KK, Chu SH, Woo J, Chan FK, Chan HL. Prevalence of non-alcoholic fatty liver disease and advanced fibrosis in Hong Kong Chinese: a population study using proton-magnetic resonance spectroscopy and transient elastography. Gut. 2012 Mar;61(3):409-15. doi: 10.1136/gutjnl-2011-300342. Epub 2011 Aug 16. PMID: 21846782.
17. Rezazadeh L, PourghassemGargari B, AsghariJafarabadi M, Alipour B. Applied nutritional investigation Effects of probiotic yogurt on glycemic indexes and endothelial dysfunction markers in patients with metabolic syndrome. Nutrition 2019; 62:162-168.. PMID: 31653483
18. Aparna Sudhakaran V, Panwar H, Chauhan R, Duary RK, Rathore RK, Batish VK, Grover S. Modulation of anti-inflammatory response in lipopolysaccharide stimulated human THP-1 cell line and mouse model at gene expression level with indigenous putative probiotic lactobacilli. Genes Nutr. 2013 Nov;8(6):637-48. doi: 10.1007/s12263-013-0347-5. Epub 2013 Jun 2. PMID: 23728791; PMCID: PMC3824826.
19. Nabi X, Ma C, Manaer T. Anti-atherosclerotic effect of traditional fermented cheese whey in atherosclerotic rabbits and identification of probiotics. BMC Complement Altern Med 2016; 16(309). PMCID: PMC4995647 PMID: 27553960
20. Riyahi Malayeri S, Kaka Abdullah Shirazi S, Behdari R, mousavi Sadati K. Effect of 8-week Swimming training and garlic intake on serum ICAM and VCAM adhesion molecules in male obese rats. JSSU 2019; 26 (10):867-878 DOI: https://doi.org/10.18502/ssu.v26i10.478
21. Hosseini M, Akbari gora F. Effect of Eight Weeks Intermittent Medium Intensity Training with Curcumin Intake on Serum Levels of ICAM-1 and VCAM-1 in Menopause Fat Rats. JRUMS. 2017; 16 (5) :409-420
URL: http://journal.rums.ac.ir/article-1-3687-en.html
22. Brown CT, Davis-Richardson AG, Giongo A, Gano KA, Crabb DB, Mukherjee N, Casella G, Drew JC, Ilonen J, Knip M, Hyöty H, Veijola R, Simell T, Simell O, Neu J, Wasserfall CH, Schatz D, Atkinson MA, Triplett EW. Gut microbiome metagenomics analysis suggests a functional model for the development of autoimmunity for type 1 diabetes. PLoS One. 2011;6(10):e25792. doi: 10.1371/journal.pone.0025792. Epub 2011 Oct 17. PMID: 22043294; PMCID: PMC3197175.
23. Nilsson A, Ostman E, Preston T, Björck I. Effects of GI vs content of cereal fibre of the evening meal on glucose tolerance at a subsequent standardized breakfast. Eur J Clin Nutr. 2008 Jun;62(6):712-20. doi: 10.1038/sj.ejcn.1602784. Epub 2007 May 23. PMID: 17522615.
24. Mishra V, Prasad DN. Application of in vitro methods for selection of Lactobacillus casei strains as potential probiotics. Int J Food Microbiol. 2005 Aug 15;103(1):109-15. doi: 10.1016/j.ijfoodmicro.2004.10.047. PMID: 16040148.
25. Conraads VM, Beckers P, Bosmans J, De Clerck LS, Stevens WJ, Vrints CJ, Brutsaert DL. Combined endurance/resistance training reduces plasma TNF-alpha receptor levels in patients with chronic heart failure and coronary artery disease. Eur Heart J. 2002 Dec;23(23):1854-60. doi: 10.1053/euhj.2002.3239. PMID: 12445534.
26. Ding YH, Young CN, Luan X, Li J, Rafols JA, Clark JC, McAllister JP 2nd, Ding Y. Exercise preconditioning ameliorates inflammatory injury in ischemic rats during reperfusion. Acta Neuropathol. 2005 Mar;109(3):237-46. doi: 10.1007/s00401-004-0943-y. Epub 2004 Dec 23. PMID: 15616790.
27. Abednatanzi H, Choopani Z. The effect of six weeks of high intensity interval training (hiit) on plasmatic levels of cellular adhesion molecules (icam-1) and lipid profile in young overweight women. Int Res J Appl Basic Sci 2014; 8(11): 2082- 8. URL: http://jmj.jums.ac.ir/article-1-35-en.html
28. Brevetti G, De Caterina M, Martone VD, Ungaro B, Corrado F, Silvestro A, de Cristofaro T, Scopacasa F. Exercise increases soluble adhesion molecules ICAM-1 and VCAM-1 in patients with intermittent claudication. Clin Hemorheol Microcirc. 2001;24(3):193-9. PMID: 11455059.
29. Dubey V, Ghosh K, Bishayee A. Probiotic pediococcus pentosaceus strain GS4 alleviates azoxymethane -induced toxicity in mice. Nutr. Res 2015; 35(10): 921-929. PMID: 26319614 DOI: 10.1016/j.nutres.2015.08.001
30. Rostamizadeh P, Mazloom Z. The Effect of Licorice and Probiotics on Nonalcoholic Fatty Liver Disease (NAFLD): A Systematic Review. Int J Nutr Sci 2019; 4(4):163-169. doi: 10.30476/IJNS.2019.84178.1042
31. Famouri F, Shariat Z, Hashemipour M, Keikha M, Kelishadi R. Effects of Probiotics on Nonalcoholic Fatty Liver Disease in Obese Children and Adolescents. J Pediatr Gastroenterol Nutr. 2017 Mar;64(3):413-417. doi: 10.1097/MPG.0000000000001422. PMID: 28230607.
32. Yeo J, Kim KI. Effect of feeding diets containing an antibiotic, a probiotic, or yucca extract on growth and intestinal urease activity in broiler chicks. Poult Sci. 1997 Feb;76(2):381-5. doi: 10.1093/ps/76.2.381. PMID: 9057222.
33. Hashida R, Kawaguchi T, Bekki M, Omoto M, Matsuse H, Nago T, Takano Y, Ueno T, Koga H, George J, Shiba N, Torimura T. Aerobic vs. resistance exercise in non-alcoholic fatty liver disease: A systematic review. J Hepatol. 2017 Jan;66(1):142-152. doi: 10.1016/j.jhep.2016.08.023. Epub 2016 Sep 14. PMID: 27639843.
34. Guo R, Liong EC, So KF, Fung ML, Tipoe GL. Beneficial mechanisms of aerobic exercise on hepatic lipid metabolism in non-alcoholic fatty liver disease. Hepatobiliary Pancreat Dis Int. 2015 Apr;14(2):139-44. doi: 10.1016/s1499-3872(15)60355-1. PMID: 25865685.
35. Rector RS, Thyfault JP. Does physical inactivity cause nonalcoholic fatty liver disease? J Appl Physiol (1985). 2011 Dec;111(6):1828-35. doi: 10.1152/japplphysiol.00384.2011. Epub 2011 May 12. PMID: 21565984.
36. Khalesi S, Johnson DW, Campbell K, Williams S, Fenning A, Saluja S, Irwin C. Effect of probiotics and synbiotics consumption on serum concentrations of liver function test enzymes: a systematic review and meta-analysis. Eur J Nutr. 2018 Sep;57(6):2037-2053. doi: 10.1007/s00394-017-1568-y. Epub 2017 Nov 8. PMID: 29119235.
The effect of aerobic training and probiotic intake on gene ICAM–1 expression in rats with nonalcoholic fatty liver |
Samaneh Hadipour Ahmadi 1, Abdolrasoul Daneshjoo*2 1- MSc in Exercise Physiology, Sport Nutrition. -3Assistant Professor of Exercise biomechanics, Department of Physical Education and Sport Sciences, East Tehran Branch, Islamic Azad University, Tehran, Iran |
Received 3 March 2021; Accepted 5 May 2021 |
Received: 9 July 2021 Revised: 11 July 2021 Accepted: 8 August 2021
Keywords: Non-alcoholic fatty liver, Probiotic, ICAM-1, ALP |
Abstract
Background: Cell adhesion molecules mediate leukocyte responses to inflammation. The purpose of study was to the effect of aerobic training and probiotic intake on ICAM–1 in rats with fatty liver. Materials and Methods: In this experimental study, 32 rats (200-250 gr) were randomly divided into four groups (healthy control, steatosis, steatosis + probiotic, steatosis + probiotic + training). To create a fatty liver model, tetracycline at a dose of 100 mg / kg in a volume of 1.5 cc was gavaged daily for two weeks. The training program includes 8 weeks and 5 sessions per week, in the initial week with a speed of 18 meters per minute, time started 10 minutes and every week quickly, 1-2 meters per minute and time was added to 10 minutes. Supplemental groups received 109 CFU / ml of Lactobacillus ramensus by gavage daily for 8 weeks and 5 days per week. Liver tissue samples were taken to examine the expression of ICAM-1 gene. 10 ml of blood was collected from the hearts of rats for ALP testing. The data was analyzed using one-way analysis of variance (ANOVA) p05/0≥. Results: The results showed that the aerobic training along with probiotic consumption significantly reduced the expression gene of ICAM-1 and ALP in rats with non-alcoholic fatty liver.
Conclusion: It seems aerobic training combined with probiotic consumption improved the expression gene of ICAM-1 and ALP enzyme in the studied samples which can be effective in treating patients with fatty liver disease.
|
Journal of Sports Physiology and Athletic Conditioning Talk |
*Corresponding author: Masoumeh Hosseini Address: Department of Physical Education and Sport Sciences, East Tehran Branch, Islamic Azad University, Tehran, Iran. Tell: 00989126844496 Email: mhbisadi@yahoo.com
|
1. Introduction |
Journal of Exercise&
|
ICAM expression in damaged hepatic stellate cells increases the entry of inflammatory molecules into them (7). Studies have shown that aerobic training by improving glucose control, lipid oxidation by increasing glucose transport in striated muscle, glycogen synthase expression and activity in insulin receptors, glycogen storage in muscle and liver, and increased triglyceride synthesis in muscle cells. reducing the accumulation of fatty acid metabolites and suppressing the inflammatory state associated with insulin resistance violate this cycle (8). Researchers have suggested a combination of proper diet and physical activity to prevent and treat this disease (9). In recent years, probiotics have been discussed as a possible alternative to treating various diseases such as NAFLD (10). The World Health Organization describes probiotics as living microorganisms that, when consumed in sufficient quantities, have beneficial effects on the host body. The reported preventive and therapeutic effects of these microorganisms include balance in the intestinal microbial flora; lowering blood cholesterol levels; improve blood pressure; Diabetes, gastrointestinal diseases; Improve the immune system and reduce the risk of various types of cancer (11, 12). Nabavi et al. (2016) reported that consumption of probiotic yogurt improved levels of liver enzymes, total cholesterol and low-density lipoprotein in the studied samples (13). Rafraf et al. (2015) reported that consumption of probiotic yogurt reduced serum ALT and AST concentrations in patients with NAFLD and may be beneficial in improving fatty liver disease (14). |
Non-alcoholic fatty liver disease is the most common liver dysfunction associated with increased accumulation of visceral fat, blood lipids, hypertension, and diabetes(1). This disease is caused by the deposition and accumulation of large fat particles in the cytoplasm of liver cells at a rate of 5% or more of liver weight and includes a wide range of symptoms from simple steatosis to steatosis with inflammation or without fibrosis and cirrhosis, the incidence of which has increased significantly in recent years as a result of obesity due to sedentary lifestyle and poor eating habits (2, 3). Common enzymes measured in liver disease include aspartate aminotransferase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP). Liver disease is the most important factor in increasing serum transaminases. ALP activity is found in most organs of the body and is particularly associated with cell surface membranes in the small intestinal mucosa and renal tubules, bone, and liver. It also increases slightly in most jaundice disorders caused by liver damage (4). Studies have shown that in NAFLD, impaired lipoprotein metabolism and accumulation of oxidized LDL increase the risk of endothelial cell damage, including adhesion molecules, and cause endothelial dysfunction. One of these molecules is the Intercellular Adhesion Molecule (ICAM-1). ICAM-1 glycoprotein is a cell surface expressed in endothelial, epithelial, fibroblast, and hepatocyte cells (5). A positive correlation has been observed between serum ICAM and the degree of hepatic fibrosis in NAFLD patients. Evidence suggests that ICAM expression is high in patients with NAFLD; several mechanisms, such as increasing oxidative stress, increase ICAM expression in NAFLD patients (6). |
Due to recent research and some contradictory results on the effect of aerobic training and probiotic consumption on ICAM-1 gene expression in fatty liver patients, also no research on the synergistic effect of training and probiotics on ICAM-1 gene expression has been studied in patients with fatty liver; the need for further studies was felt. Therefore, the researcher intended to investigate the effect of probiotic use with aerobic training on ICAM-1 in male rats with NAFLD.
|
Training protocol Table 1 shows the aerobic training protocol of rats with non-alcoholic fatty liver. Before starting the training and in order to get acquainted with how to work on the treadmill, the rats in the training group trained for five minutes at a speed of 8-10 m / min with zero slope for five sessions in one week. The main training program was done in such a way that in the first week with a speed of 18 meters per minute, the time started 10 minutes and every week quickly, 1-2 meters per minute and time was added to 10 minutes so that in the fourth week the speed 22 meters per minute and time reached 40 minutes. It was also intended to warm and cool the animals five minutes before and after training (15).
|
2. Materials and Methods |
Subjects This experimental study was conducted as a post-test design with a control group in the laboratory of the Faculty of Humanities of Sari Azad University in 2020. In this study, 32 male Wistar rats aged 10 weeks (weight range 200-250 g) were selected from the Animal Breeding Center of Sari Azad University and transferred to the laboratory. After familiarizing and adapting to the new environment, rats were randomly divided into four groups of 8 healthy, modeled (steatosis), steatosis + probiotic, steatosis + probiotic + training. All rats in standard conditions (average temperature 22 ± 2 ° C and air humidity 55 ±5% and light cycle to dark 12:12) with free access to water and food for laboratory animals in transparent polycarbonate cages in number 8 Some were kept. To produce fatty liver, tetracycline at a dose of 100 mg / kg at a volume of 1.5 cc per rat was gavaged daily for two weeks. |
Activity time (weeks)
| First
| second | Third | Fourth
| Fifth
| sixth | Seventh | Eighth |
Running time (minutes)
| 10 | 20 | 30 | 40 | 50 | 50 | 60 | 60 |
Running speed (meters per minute)
| 18 | 20 | 22 | 22 | 24 | 26 | 26 | 28 |
Table 1: Aerobic training protocol for rats with non-alcoholic fatty liver |
The inclination of the device in the exercise was zero degrees and the speed was set in meters per minute (measure of the intensity of the exercise). All stages of the above research were approved by the ethics committee of the Islamic Azad University, Sari branch, with license number 139427. Lactobacillus ramensus GG (PTCC1637) was purchased as lyophilized in standard vials from the Scientific and Industrial Research Organization of Iran (Tehran, Iran). The bacteria were cultured in MRS medium (Biogooya, Tehran, Iran) enriched with L-cysteine HCL and incubated for 24 hours in an incubator at 37 ° C. Supplementary groups received 109 CFU / ml of Lactobacillus ramensus GG by gavage daily for 8 weeks and 5 days per week (16). Animal sampling was performed 48 hours after the last training session (to eliminate the acute effect of training). For this purpose, the animals were first anesthetized by peritoneal injection of ketamine (50-30 mg / kg) and xylazine (3-5 mg / kg) and then killed. For molecular studies on the level of gene expression, tissue RNA extraction was performed in all study groups according to the protocol of the manufacturer (Kiagen, Germany). First, 200-300 Landa chiazoles were added to the Ovums and stored at -80 ° C for 24 hours. After 24 hours, the plaque in the cryotube was crushed by semi-freezing with a sampler, then slightly pipetted. About 100 Landa chloroforms were then added to the sample to lysis the cells. After 1 minute, the solution was centrifuged at 12,000 rpm for 10 minutes.
|
After centrifugation, the solution was divided into three phases: the upper part of the tube, which was clear and contained RNA, the middle part of the tube, which was white and contained lysed tissue, and the lower part of the tube, which was pink and contained chiazol. The clear liquid at the top of the tube containing the RNA was gently removed and placed in a DEPC microtube. Then 1 cc of isopropranol was poured on clear RNA and stirred by hand for 1 minute. Isopropranol is clear and RNA is clear, but when the two are mixed together they form a turbid liquid. It is better to put the obtained solution at -80 degrees overnight. After adding isopropranol, the samples were centrifuged at 12,000 rpm for 10 minutes. After removing from the centrifuge, the supernatant was drained and 1 cc of 70 alcohol was added. After vortexing, the mixture was centrifuged at 7500 rpm for 10 minutes. The supernatant was then drained with a sampler and then the plaque was dried inside a microtube. After extracting RNA with high purity and concentration from all samples, cDNA synthesis was performed according to the protocol of the manufacturer (Fermentas, USA) and then the synthesized cDNA was used for reverse transcription reaction. |
Gene | Primer Sequence (5′-3′) | Product Size (bp) | Accession Number |
ICAM1 | F: CGCCAGAGGAAGATCAGGAT | 162 | NM_012967.1 |
R: AGGTGGGTGAGGGGTAAATG | |||
GAPDH | F: CAAGTTCAAGGGCACAGTCA | 102 | NM_017008.4 |
R: CCCCATTTGATGTTAGCGGG |
Table 2: Design of specific gene primers |
Serum ALP enzyme activity was measured using Pars Azmoun kits with a sensitivity of less than 3 international units per liter and a coefficient of variation of 1.4% with the help of RA-1000 autoanalyzer manufactured by Techni Com Company by enzymatic metering method. The required collected information was analyzed by SPSS software version 24 at a significant level (P≥0.05). Kolmogorov-Smirnov test was used to determine the normality of data distribution and Leven test was used to check the homogeneity of variances. To determine the significance of the differences between the variables between the research groups, one-way analysis of variance and Ben Foroni post hoc test were used.
|
First, all designed primers related to all genes were examined and then gene expression was evaluated using quantitative q-RT PCR. The RT-qPCR technique was used to quantitatively confirm the expression of the studied genes. For this purpose, using chiazol solution, the RNA of all cells was extracted according to the synagen protocol and exposed to DNase I Fermentas to ensure contamination with genomic DNA. Then the quality of the extracted RNAs was evaluated by spectrophotometry (Kiagen DPI-1). To prepare a single-stranded cDNA from primer (Oligo dt MWG-Biotech, Germany) and reverse transcription enzyme (Fermentas) was performed according to the relevant protocol. To design gene-specific primers, the gene sequence encoding ICAM-1 (as the target gene) and the GAPDH sequence (as the reference gene) were first extracted from the National Center for Biotechnology Information (NCBI) database. Then, primer pairs were designed using Fast PCR software (Table 2).
|
3. Results |
The results showed that there was a significant difference between the ALP variable in the four groups (P = 0.000); There was a difference between the control group with all groups and the patient group with the probiotic group and the training + probiotic group.
|
Figure 1 shows Comparison of the average ICAM-1 (Pico g / ml) of the four groups. Figure 2 shows Comparison of the average ALP (International Unit per Liter) of the four groups .The results of one-way analysis of variance showed that there was a significant difference between the expression variables of ICAM-1 gene in the four study groups (P = 0.001), which was the difference between the control group with the patient group and the patient group with the training + probiotic group.
|
Figure 1. Comparison of the average ICAM-1 (Pico g / ml) of the four groups
Figure 2. Comparison of the average ALP (International Unit per Liter) of the four groups
Regular training seems to inhibit the release of inflammatory mediators from adipose tissue by decreasing sympathetic stimulation and increasing anti-inflammatory cytokines, followed by a decrease in ICAM-1 concentration (26). Mechanisms of ICAM-1 reduction after training can depend on the amount of training, intensity, duration and frequency of training sessions. Decreased inflammatory index of ICAM-1 may be due to the antioxidant effects of aerobic training. Because free radicals increase ICAM-1 inflammatory mediator expression, Aerobic training by reducing anti-oxidative defenses can lead to a decrease in inflammatory markers (27). Several studies confirm the effectiveness of IL-6 in increasing ICAM-1. Studies have shown that training, especially aerobic training, as well as probiotic supplementation have an effective role in reducing tumor necrosis factor alpha and interleukin-6; Therefore, it seems that reducing the levels of these inflammatory cytokines due to training is also effective in reducing ICAM-1. Reduction of proinflammatory factors also reduces the release of chemical mediators such as NF-KB, which can be effective in modulating inflammation. NF-KB is inactive in the cytoplasm and mediates ICAM-1 translation (26). Brevetti et al. (2001) reported an increase in ICAM-1 after maximum intensity training, which is not consistent with the results of a recent study (28). |
The results showed that eight weeks of aerobic training with probiotics significantly reduced ICAM-1 gene expression in rats with non-alcoholic fatty liver disease compared to the modeled group (steatosis). The results of research by Rezazadeh et al. (2020) showed that probiotic consumption significantly reduced ICAM-1 in patients with metabolic syndrome (17). Sudhakaran et al. (2013) in a study reported a significant decrease in ICAM-1 in rats due to probiotic use (18). Nabi et al. (2016) also reported in a study that probiotic consumption significantly reduced ICAM-1 in atherosclerotic rabbits (19). Riyahi et al. (2017) in their study showed that eight weeks of swimming training and garlic consumption significantly reduced ICAM-1 in obese mice (20). Hosseini et al. (2017) also reported a significant decrease in ICAM-1 in obese postmenopausal rats due to eight weeks of intense intermittent training with curcumin (21), which is consistent with the results of the present study.Probiotic bacteria, along with other beneficial nutrients, appear to alter metabolic pathways and reduce endogenous cholesterol synthesis by fermenting dietary fiber and producing short-chain fatty acids such as acetic acid. Because inflammatory markers increase in heart disease, by controlling the level of inflammation as a risk factor for cardiovascular disease, the complications of the disease can be better controlled (22). Recent studies have shown that probiotics, including lactobacilli, are able to reduce inflammatory responses in animal models, possibly as a result of the effect of probiotics in improving lipid profile levels (23). Mishra et al. (2015) showed that probiotics have antioxidant power (24). These antioxidant effects are effective in preventing or reducing endothelial damage and inflammation by reducing LDL oxidation (25). |
4. Discussion |
Probiotics can also be used to treat fatty liver by lowering circulating pro-inflammatory cytokines and lipopolysaccharides and reducing inflammation and thus reducing insulin resistance, preventing the destruction of pancreatic beta cells and lowering the level of cholesterol and harmful blood lipoproteins. On the other hand, aerobic training and muscle endurance training can improve NAFLD by activating lipolysis, increasing the regulation of UCP-1 (Uncoupling protein-1) and PPARγ (Peroxisome proliferator-activated receptor γ) and changes in adipocytokines (33). Guo et al. In a review article stated that aerobic training can be effective in improving NAFLD by reducing visceral and peripheral fat reserves and increasing the uptake of free fatty acids by the liver and inhibiting and modulating oxidative stress, inflammation and hepatic apoptosis (34).Training can also help reduce liver steatosis and prevent the progression of cirrhosis, and can be effective in improving insulin sensitivity, reducing insulin resistance, and cardiovascular health, which is the leading cause of death in these patients (35).Hosseini et al (2017) reported a significant decrease in ICAM-1 in obese postmenopausal rats due to eight weeks of intense intermittent training (21). The results of Khalesi et al. (2018) showed that there was no significant change in ALP in adults due to probiotic use (36), which is inconsistent with the results of the present study. The cause of this mismatch can be attributed to the type of subjects. Mousavi Nezhad et al. (2015) reported in a study that the use of probiotics significantly increased ALP rats with non-alcoholic fatty liver (8). The reason for this discrepancy can be due to differences in species and dose of probiotic bacteria consumed, intervention length, sample size and clinical characteristics of the subjects.
|
Differences in the results of this study may be due to differences in the type of subjects, training protocol and the length of the research period. The Brevetti specimens had intermittent tremor and their training protocol was acute. Another result of the present study was a significant decrease in ALP due to eight weeks of aerobic training with the use of probiotics in rats with non-alcoholic fatty liver compared to the modeled group (steatosis). Consistent with the present results, a study conducted by Dubey et al. (2015) on mice showed that probiotic consumption reduced blood ALP levels (29). Rostamizadeh et al (2017) reported in a study that probiotic consumption significantly reduced ALP in patients with non-alcoholic fatty liver disease compared to the modeled group (steatosis) (30). Famouri et al (2017) in a study of obese adolescents with non-alcoholic fatty liver showed that the levels of liver enzymes and cholesterol in the group that took probiotic capsules (Bacillus acidophilus) were much lower than in the control group (31). Probiotics improve liver function by reducing the activity of the bacterial urease enzyme in intestinal absorption of ammonia and toxins and reducing oxidative stress due to ammonia absorption, and possibly lower liver ALP enzyme levels because probiotics balance intestinal Increasing the digestibility of nutrients and increasing the immune response reduces intestinal toxins and therefore decreases the serum level of this enzyme by increasing its functions (32). |
Compliance with ethical standards |
Conclusion
|
The results of this study showed that aerobic training and probiotic consumption in rats with non-alcoholic fatty liver disease can affect the inhibition of adhesion molecules and significantly reduce ICAM-1 and ALP. Therefore, aerobic training can be a good solution to reduce fat stores, prevent inflammation and reduce non-alcoholic fatty liver disease, and the use of probiotics in the range of health, along with training can be effective in achieving better results and as an adjunctive therapy to be used for patients with NAFLD.
|
Conflict of interest None declared. Ethical approval The Ethics Committee of Islamic Azad University East Tehran Branch approved the study. Informed consent Informed consent was obtained from all participants.
|
Author contributions
|
Conceptualization: S.H.A., M.H., A.D.; Methodology: S.H.A., M.H., A.D.; Software: S.H.A., M.H., A.D.; Validation: S.H.A., M.H., A.D.; Formal analysis: S.H.A., M.H., A.D.; Investigation: S.H.A., M.H., A.D.; Resources: S.H.A., M.H., A.D.; Data curation: S.H.A., M.H., A.D.; Writing - original draft: S.H.A., M.H., A.D.; Writing - review & editing: S.H.A., M.H., A.D.; Visualization: S.H.A., M.H., A.D.; Supervision: S.H.A., M.H., A.D.; Project administration: S.H.A., M.H., A.D.; Funding acquisition: S.H.A., M.H., A.D.
|
Acknowledgements |
The present study is the result of Samaneh Hadipoor's master's thesis, approved by Islamic Azad University, East Tehran Branch in 2020. The researcher expresses his gratitude and thanks to the professors of the Islamic Azad University, East Tehran Branch and the esteemed officials of the Sari Animal Laboratory who helped us in this project.
|
Funding This study did not have any funds. |
References |
1. Farzanegi P, Pour Amin Z, Habibian M. Changes of Liver Trans-Aminases after a Period of Selected Aerobic Training in Postmenopausal Women. Med Laboratory J 2014; 8(1): 22-8. URL: http://mlj.goums.ac.ir/article-1-406-en.html 2. Bacchi E, Negri C, Targher G, Faccioli N, Lanza M, Zoppini G, Zanolin E, Schena F, Bonora E, Moghetti P. Both resistance training and aerobic training reduce hepatic fat content in type 2 diabetic subjects with nonalcoholic fatty liver disease (the RAED2 Randomized Trial). Hepatology. 2013 Oct;58(4):1287-95. doi: 10.1002/hep.26393. Epub 2013 Aug 22. PMID: 23504926. 3. Masarone M, Federico A, Abenavoli L, Loguercio C, Persico M. Non alcoholic fatty liver: epidemiology and natural history. Rev Recent Clin Trials. 2014;9(3):126-33. doi: 10.2174/1574887109666141216111143. PMID: 25514916. 4. Liu Z, Que S, Xu J, Peng T. Alanine aminotransferase-old biomarker and new concept: a review. Int J Med Sci. 2014 Jun 26;11(9):925-35. doi: 10.7150/ijms.8951. PMID: 25013373; PMCID: PMC4081315. 5. Eschen O, Christensen JH, Toft E, Schmidt EB. Soluble adhesion molecules and marine n-3 fatty acids in patients referred for coronary angiography. Atherosclerosis. 2005 Jun;180(2):327-31. doi: 10.1016/j.atherosclerosis.2004.12.006. Epub 2005 Jan 24. PMID: 15910859. 6. Lin G, Duan X, Cai X, Tian L, Xu Z, Fan J. Hepatocyte steatosis increases the expression of adhesion molecules in endothelial cells. Asian Biomedicine 2010; 4(5): 757-63. DOI: 10.2478/abm-2010-0098 7. Lebda MA. Acute Iron Overload and Potential Chem-otherapeutic Effect of Turmeric in Rats. Int J Pure App Biosci 2014; 2(2):86-94.I SSN: 2320 – 7051 INTERNATIONAL JOURNAL OF PURE & APPLIED BIOSCIENCE 8. Mousavi Nezhad S A, Jafari P, Tajabadi Ebrahimi M, Zilabi R. The Effect of Iran Probiotic Fermented Milk Beverage on Cholesterol and Liver Function Biomarkers of Rat. J Police Med. 2015; 4 (1) :49-56 9. Thoma C, Day CP, Trenell MI. Lifestyle interventions for the treatment of non-alcoholic fatty liver disease in adults: a systematic review. J Hepatol. 2012 Jan;56(1):255-66. doi: 10.1016/j.jhep.2011.06.010. Epub 2011 Jul 1. PMID: 21723839.
|
10. Lata J, Jurankova J, Kopacova M, Vitek P. Probiotics in hepatology. World J Gastroenterol. 2011 Jun 28;17(24):2890-6. doi: 10.3748/wjg. v17.i24.2890. PMID: 21734800; PMCID: PMC3129503. 11. Lye HS, Kuan CY, Ewe JA, Fung WY, Liong MT. The improvement of hypertension by probiotics: effects on cholesterol, diabetes, renin, and phytoestrogens. Int J Mol Sci. 2009 Aug 27;10(9):3755-75. doi: 10.3390/ijms10093755. PMID: 19865517; PMCID: PMC2769158. 12. Iacono A, Raso GM, Canani RB, Calignano A, Meli R. Probiotics as an emerging therapeutic strategy to treat NAFLD: focus on molecular and biochemical mechanisms. J Nutr Biochem. 2011 Aug;22(8):699-711. doi: 10.1016/j.jnutbio.2010.10.002. Epub 2011 Feb 2. PMID: 21292470. 13. Nabavi S, Rafraf M, Somi MH, Homayouni-Rad A, Asghari-jafarabadi M. The effects of probiotic yogurt on metabolic factors in nonalcoholic fatty liver disease. SJKU 2016; 20 (6):12-25. PMID: 25306266 DOI: 10.3168/jds.2014-8500 14. Rafraf M, Nabavi S, Somi M, Homayouni-Rad A, Asghari-Jafsrabadi M. Effect of Probiotic Yogurt on Enzymes and Ecogenisity of Liver in Individuals with non-Alcoholic Fatty Liver Disease: A Double-Blind Randomized Controlled Clinical Trial. J Adv Med Biomed Res 2015; 23 (99):25-38. PMID: 25306266 DOI: 10.3168/jds.2014-8500. 15. Shirvani H, Aslani J. The effects of high-intensity interval training vs. moderate-intensity continuous training on serum irisin and expression of skeletal muscle PGC-1α gene in male rats. Tehran Univ Med J. 2017; 75 (7) :513-520 16. Wong VW, Chu WC, Wong GL, Chan RS, Chim AM, Ong A, Yeung DK, Yiu KK, Chu SH, Woo J, Chan FK, Chan HL. Prevalence of non-alcoholic fatty liver disease and advanced fibrosis in Hong Kong Chinese: a population study using proton-magnetic resonance spectroscopy and transient elastography. Gut. 2012 Mar;61(3):409-15. doi: 10.1136/gutjnl-2011-300342. Epub 2011 Aug 16. PMID: 21846782.
|
24. Mishra V, Prasad DN. Application of in vitro methods for selection of Lactobacillus casei strains as potential probiotics. Int J Food Microbiol. 2005 Aug 15;103(1):109-15. doi: 10.1016/j.ijfoodmicro.2004.10.047. PMID: 16040148. 25. Conraads VM, Beckers P, Bosmans J, De Clerck LS, Stevens WJ, Vrints CJ, Brutsaert DL. Combined endurance/resistance training reduces plasma TNF-alpha receptor levels in patients with chronic heart failure and coronary artery disease. Eur Heart J. 2002 Dec;23(23):1854-60. doi: 10.1053/euhj.2002.3239. PMID: 12445534. 26. Ding YH, Young CN, Luan X, Li J, Rafols JA, Clark JC, McAllister JP 2nd, Ding Y. Exercise preconditioning ameliorates inflammatory injury in ischemic rats during reperfusion. Acta Neuropathol. 2005 Mar;109(3):237-46. doi: 10.1007/s00401-004-0943-y. Epub 2004 Dec 23. PMID: 15616790. 27. Abednatanzi H, Choopani Z. The effect of six weeks of high intensity interval training (hiit) on plasmatic levels of cellular adhesion molecules (icam-1) and lipid profile in young overweight women. Int Res J Appl Basic Sci 2014; 8(11): 2082- 8. URL: http://jmj.jums.ac.ir/article-1-35-en.html 28. Brevetti G, De Caterina M, Martone VD, Ungaro B, Corrado F, Silvestro A, de Cristofaro T, Scopacasa F. Exercise increases soluble adhesion molecules ICAM-1 and VCAM-1 in patients with intermittent claudication. Clin Hemorheol Microcirc. 2001;24(3):193-9. PMID: 11455059. 29. Dubey V, Ghosh K, Bishayee A. Probiotic pediococcus pentosaceus strain GS4 alleviates azoxymethane -induced toxicity in mice. Nutr. Res 2015; 35(10): 921-929. PMID: 26319614 DOI: 10.1016/j.nutres.2015.08.001 30. Rostamizadeh P, Mazloom Z. The Effect of Licorice and Probiotics on Nonalcoholic Fatty Liver Disease (NAFLD): A Systematic Review. Int J Nutr Sci 2019; 4(4):163-169. doi: 10.30476/IJNS.2019.84178.1042 31. Famouri F, Shariat Z, Hashemipour M, Keikha M, Kelishadi R. Effects of Probiotics on Nonalcoholic Fatty Liver Disease in Obese Children and Adolescents. J Pediatr Gastroenterol Nutr. 2017 Mar;64(3):413-417. doi: 10.1097/MPG.0000000000001422. PMID: 28230607. 32. Yeo J, Kim KI. Effect of feeding diets containing an antibiotic, a probiotic, or yucca extract on growth and intestinal urease activity in broiler chicks. Poult Sci. 1997 Feb;76(2):381-5. doi: 10.1093/ps/76.2.381. PMID: 9057222.
|
17. Rezazadeh L, PourghassemGargari B, AsghariJafarabadi M, Alipour B. Applied nutritional investigation Effects of probiotic yogurt on glycemic indexes and endothelial dysfunction markers in patients with metabolic syndrome. Nutrition 2019; 62:162-168.. PMID: 31653483 18. Aparna Sudhakaran V, Panwar H, Chauhan R, Duary RK, Rathore RK, Batish VK, Grover S. Modulation of anti-inflammatory response in lipopolysaccharide stimulated human THP-1 cell line and mouse model at gene expression level with indigenous putative probiotic lactobacilli. Genes Nutr. 2013 Nov;8(6):637-48. doi: 10.1007/s12263-013-0347-5. Epub 2013 Jun 2. PMID: 23728791; PMCID: PMC3824826. 19. Nabi X, Ma C, Manaer T. Anti-atherosclerotic effect of traditional fermented cheese whey in atherosclerotic rabbits and identification of probiotics. BMC Complement Altern Med 2016; 16(309). PMCID: PMC4995647 PMID: 27553960 20. Riyahi Malayeri S, Kaka Abdullah Shirazi S, Behdari R, mousavi Sadati K. Effect of 8-week Swimming training and garlic intake on serum ICAM and VCAM adhesion molecules in male obese rats. JSSU 2019; 26 (10):867-878 DOI: https://doi.org/10.18502/ssu.v26i10.478 21. Hosseini M, Akbari gora F. Effect of Eight Weeks Intermittent Medium Intensity Training with Curcumin Intake on Serum Levels of ICAM-1 and VCAM-1 in Menopause Fat Rats. JRUMS. 2017; 16 (5) :409-420 22. Brown CT, Davis-Richardson AG, Giongo A, Gano KA, Crabb DB, Mukherjee N, Casella G, Drew JC, Ilonen J, Knip M, Hyöty H, Veijola R, Simell T, Simell O, Neu J, Wasserfall CH, Schatz D, Atkinson MA, Triplett EW. Gut microbiome metagenomics analysis suggests a functional model for the development of autoimmunity for type 1 diabetes. PLoS One. 2011;6(10):e25792. doi: 10.1371/journal.pone.0025792. Epub 2011 Oct 17. PMID: 22043294; PMCID: PMC3197175. 23. Nilsson A, Ostman E, Preston T, Björck I. Effects of GI vs content of cereal fibre of the evening meal on glucose tolerance at a subsequent standardized breakfast. Eur J Clin Nutr. 2008 Jun;62(6):712-20. doi: 10.1038/sj.ejcn.1602784. Epub 2007 May 23. PMID: 17522615.
|
33. Hashida R, Kawaguchi T, Bekki M, Omoto M, Matsuse H, Nago T, Takano Y, Ueno T, Koga H, George J, Shiba N, Torimura T. Aerobic vs. resistance exercise in non-alcoholic fatty liver disease: A systematic review. J Hepatol. 2017 Jan;66(1):142-152. doi: 10.1016/j.jhep.2016.08.023. Epub 2016 Sep 14. PMID: 27639843. 34. Guo R, Liong EC, So KF, Fung ML, Tipoe GL. Beneficial mechanisms of aerobic exercise on hepatic lipid metabolism in non-alcoholic fatty liver disease. Hepatobiliary Pancreat Dis Int. 2015 Apr;14(2):139-44. doi: 10.1016/s1499-3872(15)60355-1. PMID: 25865685. 35. Rector RS, Thyfault JP. Does physical inactivity cause nonalcoholic fatty liver disease? J Appl Physiol (1985). 2011 Dec;111(6):1828-35. doi: 10.1152/japplphysiol.00384.2011. Epub 2011 May 12. PMID: 21565984. 36. Khalesi S, Johnson DW, Campbell K, Williams S, Fenning A, Saluja S, Irwin C. Effect of probiotics and synbiotics consumption on serum concentrations of liver function test enzymes: a systematic review and meta-analysis. Eur J Nutr. 2018 Sep;57(6):2037-2053. doi: 10.1007/s00394-017-1568-y. Epub 2017 Nov 8. PMID: 29119235.
|